View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8666_low_8 (Length: 253)
Name: NF8666_low_8
Description: NF8666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8666_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 4 - 238
Target Start/End: Complemental strand, 43934254 - 43934020
Alignment:
| Q |
4 |
atcaatgagatggacatcaggaaatcatatcaacacagcgggagggacacgtttcgttcaaattattcgactggtttttccccggtgaaaaagcaaacta |
103 |
Q |
| |
|
||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43934254 |
atcaatgagcttaacagcaggaaatcatatcaacacagcgggagggacacgtttcgttcaaattattcgactggtttttccccggtgaaaaagcaaacta |
43934155 |
T |
 |
| Q |
104 |
tggctagttacgatcaaataaaggtaaaatttattagagaatttatattgaaggttgcagctcgtgggtgatagagtttccttacagttatatctgttct |
203 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43934154 |
tggctagttacgatgaaataaaggtaaaatttattagataatttatattgaaggttgcagctcatgggtgatagagtttccttacagttatatctgttct |
43934055 |
T |
 |
| Q |
204 |
tttggttggacacattttttactgtttctgtgctc |
238 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
43934054 |
tttggttgaacacattttttactgtttctgtgctc |
43934020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University