View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8666_low_9 (Length: 222)
Name: NF8666_low_9
Description: NF8666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8666_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 8184560 - 8184401
Alignment:
| Q |
1 |
aggtttggtttaacttaaccatttctcatgtttgaataatggtataaaaagaaattcctacatannnnnnnnnnnnngtctacttgcagaatttcaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
8184560 |
aggtttggtttaacttaaccatttctcatgtttgaataatggtataaaaagaaatttctacatttttttgtttttttgtctacttgcagaatttcaattc |
8184461 |
T |
|
| Q |
101 |
ccttatggattaaattgcacgcaacttcctaatcgggttgatttgtaaatgacgaaagat |
160 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8184460 |
ccttatggattaaattgcgtgcaacttcctaatcgggttgatttgtaaatgacgaaagat |
8184401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 8184379 - 8184339
Alignment:
| Q |
182 |
tgatctaccaccttaaatagttaaaatgatttttgaccgat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8184379 |
tgatctaccaccttaaatagttaaaatgatttttgaccgat |
8184339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University