View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8666_low_9 (Length: 222)

Name: NF8666_low_9
Description: NF8666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8666_low_9
NF8666_low_9
[»] chr3 (2 HSPs)
chr3 (1-160)||(8184401-8184560)
chr3 (182-222)||(8184339-8184379)


Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 8184560 - 8184401
Alignment:
1 aggtttggtttaacttaaccatttctcatgtttgaataatggtataaaaagaaattcctacatannnnnnnnnnnnngtctacttgcagaatttcaattc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||              |||||||||||||||||||||||    
8184560 aggtttggtttaacttaaccatttctcatgtttgaataatggtataaaaagaaatttctacatttttttgtttttttgtctacttgcagaatttcaattc 8184461  T
101 ccttatggattaaattgcacgcaacttcctaatcgggttgatttgtaaatgacgaaagat 160  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||    
8184460 ccttatggattaaattgcgtgcaacttcctaatcgggttgatttgtaaatgacgaaagat 8184401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 8184379 - 8184339
Alignment:
182 tgatctaccaccttaaatagttaaaatgatttttgaccgat 222  Q
    |||||||||||||||||||||||||||||||||||||||||    
8184379 tgatctaccaccttaaatagttaaaatgatttttgaccgat 8184339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University