View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8669_high_6 (Length: 237)
Name: NF8669_high_6
Description: NF8669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8669_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 45725147 - 45724939
Alignment:
| Q |
1 |
acctaataatttaagcgtacacgcttccatgaatactatgcatgagtcatgagtc-------cctctcctcaatccccaaaattgttgagaatgcattta |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725147 |
acctaataatttaagcgtacacgcttccatgaatactatgcatgagtcatgagtcatgagtccctctcctcaatccccaaaattgttgagaatgcattta |
45725048 |
T |
 |
| Q |
94 |
atttgattttatatacttttggttatttaattaatttgcttgtttagctactacgtttaggtgacgaatgcaaatatcattcactcactcacagtgcatg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
45725047 |
atttgattttatatacttttggttatttaattaattatcttgtttagctactacgtttaggtgacgaatgcaaatatcat----tcacccacagtgcatg |
45724952 |
T |
 |
| Q |
194 |
cagagttagtgtg |
206 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45724951 |
cagagttagtgtg |
45724939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University