View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8669_low_12 (Length: 220)
Name: NF8669_low_12
Description: NF8669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8669_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 2 - 198
Target Start/End: Original strand, 3713656 - 3713852
Alignment:
| Q |
2 |
gaaattatgatgatattatgatttcattgaaagtctaaagtgcaacttttacaaaaataatagtagaataccctaatttgatcaaattcaacttcacatt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||| ||||| |
|
|
| T |
3713656 |
gaaattatgatgatattatgatttcattgaaagtctaaagtgcaacttttataaaaataatagtagcataccctaatttgaccaaattcaactttacatt |
3713755 |
T |
 |
| Q |
102 |
tataaagttgctggaggaaaagttcttcttaataacggtgtcgttgataatcattttacgattgttttataagatttgatgttgtcttttgaattac |
198 |
Q |
| |
|
|||||||| | || ||||||||||||| ||||||| |||||||||||||||||||||| ||| |||||| ||||||||||||||||||||| |||| |
|
|
| T |
3713756 |
tataaagtcgttgaaggaaaagttcttattaataatagtgtcgttgataatcattttacaattattttatgagatttgatgttgtcttttgagttac |
3713852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University