View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8670_low_13 (Length: 294)
Name: NF8670_low_13
Description: NF8670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8670_low_13 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 123 - 294
Target Start/End: Original strand, 5415659 - 5415830
Alignment:
| Q |
123 |
gataaatcgttgatatatcaagtgtgagtaagagtcttacatttgaaaaagtggatgttgagcaagatttaagtaaagagactcgtatatctaatgtctt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
5415659 |
gataaatcgttgatatatcaagtgtgagtaagagtcttacatttggaaaagtggattttgaataagatttaagtaaagagatccatatatctaatgtctt |
5415758 |
T |
|
| Q |
223 |
tagcttttggacgaagatgtggtgttcaaataacttatgtttactctcagatcaatgtgatgatttgccaat |
294 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5415759 |
tagcttttgaacgaagatgtggtgttcaaataacttatgtttgctctcagatcaatgtgatgatttgccaat |
5415830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University