View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8670_low_14 (Length: 284)
Name: NF8670_low_14
Description: NF8670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8670_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 6 - 267
Target Start/End: Original strand, 24760821 - 24761082
Alignment:
| Q |
6 |
tttggtgttcgcgtcatgatctctgatattgtagccgatgtagcctaatcgcggctgcattgtggtttaggcaacatnnnnnnnncgttatgccacagca |
105 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24760821 |
tttggagttcgcgtcatgatctctgatattgtagccgatgtagcctaatcgcggctgcattgtggtttaggcaacataaaaaaaacgttatgccacagca |
24760920 |
T |
|
| Q |
106 |
gcctagattgtatttttggaccttttgtttaataccctagtgaagggttacttcaatttttgtgatataagaaactcacatcagtggttctttggaaatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
24760921 |
gcctagattgtatttttggaccttttgtttaataccctagtgaagggttacttcaatttttgtgatgtaagaaactcacatcagtggttcttaggaaatt |
24761020 |
T |
|
| Q |
206 |
aattgatgtgtctcgttatcttaatgattcgattcattcatcatgtttcctgtgaggagagt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24761021 |
aattgatgtgtctcgttatcttaatgattcgattcattcatcatgtttcctgtgaggagagt |
24761082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University