View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8670_low_15 (Length: 264)
Name: NF8670_low_15
Description: NF8670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8670_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 29 - 248
Target Start/End: Original strand, 19575164 - 19575383
Alignment:
| Q |
29 |
gtatgatacttgaactataaggtattgtgtaatgtatttgtattggttgtgtgaggagaaggccttggagttgttggtatttatagagtgggaagggaaa |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19575164 |
gtatgatacttgaactataaggtattgtgtaatgtatttgtattggttgtgtgagtagaaggcattggagttgttggtatttatagagtgggaagggaaa |
19575263 |
T |
 |
| Q |
129 |
gcacatggttttgatgcaaaatcataactttgtgttttaccatcatatagcaaaaaggtgggtatggattctttgtaataagtaataagaatggttatga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19575264 |
gcacatggttttgatgcaaaatcataactttgtgttttaccatcatatagcaaaaaggtgggtatggattctttgtaataagtaataagaatggttatga |
19575363 |
T |
 |
| Q |
229 |
attatcatggttgtaaaaag |
248 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
19575364 |
attatcatggttgtaaaaag |
19575383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University