View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8670_low_17 (Length: 242)
Name: NF8670_low_17
Description: NF8670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8670_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 19577361 - 19577152
Alignment:
| Q |
19 |
gtttcatccttccgcgaaattcataattatgctaaacccaccccccaaaacattaaccacacctccattgttttaatcaactggggctctcataaagatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19577361 |
gtttcatccttccgcgaaattcataattatgctaaacccaccccccaaaacattaaccacacctccattgttttaatcaactggggctctcataaagatc |
19577262 |
T |
|
| Q |
119 |
ttcgcaaaatacttaacttaggtccttatgctactatcttcgttatcgatagtcaccgtccgattcatcttcataatctcagtgaccagaatgattctgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19577261 |
ttcgcaaaatacttaacttaggtccttatgctactatcttcgttatcgatagtcaccgtccgattcatcttcataatctcagtgaccagaatgattctgt |
19577162 |
T |
|
| Q |
219 |
tgttgttctt |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
19577161 |
tgttgttctt |
19577152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University