View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8670_low_22 (Length: 201)
Name: NF8670_low_22
Description: NF8670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8670_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 43452632 - 43452766
Alignment:
| Q |
1 |
tttgataattttttcaaataataattaaatgacttgtgagtgaccatgcatgctccatgcacatggttttaaatagtgtacaattgaag--nnnnnnnnn |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43452632 |
tttgataattttttcaaataataattaaatgacttgtgagtgaccatgcgtgctccatgcacatggttttaaatagtgtacaattgaagaaaaaaaaaat |
43452731 |
T |
|
| Q |
99 |
nttatattcaaaactgaaaattacgtccattgaga |
133 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
43452732 |
attatattcaaaacagaaaattacgtccattgaga |
43452766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University