View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8671_high_13 (Length: 216)
Name: NF8671_high_13
Description: NF8671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8671_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 26734717 - 26734536
Alignment:
| Q |
17 |
aacctgtgtatgtagtgaaacatgaaagcacctgaatgtcatgcatgatggtttatttcccaaattgaaccaaaaaacgatacaactgcaaacaaaagag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26734717 |
aacctgtgtatgtagtgaaacatgaaagcacctgaatgtcatgcatgatggtttatttcccaaattgaaccaaaaaacgatacaactgcaaacaaaa-ag |
26734619 |
T |
 |
| Q |
117 |
aatccgaacatgctctaacaaagagagaaaatatttgtcccataaccataacttagttgacagggacattgtattttatatgt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||| |||| |
|
|
| T |
26734618 |
aatccgaacatgctctaacaaagagagaaaatatttgtcccatgaccataacttagttggtagaaacattgtattttacatgt |
26734536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University