View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8671_low_15 (Length: 295)
Name: NF8671_low_15
Description: NF8671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8671_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 54 - 160
Target Start/End: Original strand, 33868341 - 33868447
Alignment:
| Q |
54 |
ccaactttaaaagggttttgaataaaacaatcttctcatagtgagtgacaattcttaaattctttataatgattatcttactaagattaaattataaaat |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33868341 |
ccaactttaaaagggttttgaataaaacaatcttctcatagggagtgacaattcttaaattctttataatgattatcttactaagattaaattataaaat |
33868440 |
T |
|
| Q |
154 |
atatgtt |
160 |
Q |
| |
|
||||||| |
|
|
| T |
33868441 |
atatgtt |
33868447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 159 - 262
Target Start/End: Original strand, 33869517 - 33869620
Alignment:
| Q |
159 |
ttcatttcttacaaggatggatgcatgtcactacataatttacgtgggataatgaatgagacagataatttaggtgnnnnnnncaccaacaatgtaacaa |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33869517 |
ttcatttcttacaaggatggatgcatgtcactacataatttacgtgggataatgaatgagacagataatttaggtgaaaaaaacaccaacaatgtaacaa |
33869616 |
T |
|
| Q |
259 |
ttta |
262 |
Q |
| |
|
|||| |
|
|
| T |
33869617 |
ttta |
33869620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University