View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8671_low_16 (Length: 290)
Name: NF8671_low_16
Description: NF8671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8671_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-144; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 36643164 - 36643437
Alignment:
| Q |
1 |
gcaggtgagatacgagaaggggtatgcagccgtttgaggcctcagctgttacacaccctactgttctctaggtgtcgcaatgcaatttggggcatcataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36643164 |
gcaggtgagatacgagaaggggtatgcagccgtttgaggcctcagctgttacacatcctaccgttctctaggtgtcgcaatacaatttggggcatcataa |
36643263 |
T |
|
| Q |
101 |
gaggacacaagattccagagttgttttctatgcctagtaaacaagagaaggtgaagcaaacatctttattgaaagccttttcttgggtgatgggcttgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36643264 |
gaggacacaagattccagagttgttttctatgcctagtaaacaagagaaggtgaagcaaacatctttattgaaagcctttgcttgggtgatgggcttgac |
36643363 |
T |
|
| Q |
201 |
caagaaagtgcctatggtggggttgaatgctgttggccaacttttcagtaagagtctgagcaatgaggagttga |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36643364 |
caagaaagtgcctatggtggggttgaatgctgttggccaacttttcagtaagagtctgagcaatgaggagttga |
36643437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 36650406 - 36650285
Alignment:
| Q |
1 |
gcaggtgagatacgagaaggggtatgcagccgtttgaggcctcagctgttacacaccctactgttctctaggtgtcgcaatgcaatttggggcatcataa |
100 |
Q |
| |
|
||||||||||||||||| ||||| | ||||||||||||||| |||||||||||| |||||| |||||||||||||| | |||||| |||||||||||||| |
|
|
| T |
36650406 |
gcaggtgagatacgagatggggtgtacagccgtttgaggccgcagctgttacacgccctaccgttctctaggtgtcactatgcaacttggggcatcataa |
36650307 |
T |
|
| Q |
101 |
gaggacacaagattccagagtt |
122 |
Q |
| |
|
||||||||| | ||||||||| |
|
|
| T |
36650306 |
taggacacaataatccagagtt |
36650285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 170 - 274
Target Start/End: Complemental strand, 36650261 - 36650157
Alignment:
| Q |
170 |
tgaaagccttttcttgggtgatgggcttgaccaagaaagtgcctatggtggggttgaatgctgttggccaacttttcagtaagagtctgagcaatgagga |
269 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||| ||||||||||| |||| || |
|
|
| T |
36650261 |
tgaaagcctttgcttgggtgatgggcttgaccaagaaagtgcccttggtcgggttcaatgctgttggccaacttttcagtgagagtctgagcgatgaaga |
36650162 |
T |
|
| Q |
270 |
gttga |
274 |
Q |
| |
|
||||| |
|
|
| T |
36650161 |
gttga |
36650157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University