View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8671_low_19 (Length: 247)
Name: NF8671_low_19
Description: NF8671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8671_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 45070269 - 45070505
Alignment:
| Q |
1 |
agccagcctgacagggacacccatgtatccaccaacaaagccttcaaacttatttggttacttgtgnnnnnnnn--------gcgaatttgtctgaattc |
92 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45070269 |
agccagcctgacagtgccacccatgtatccaccaacaaagccttcaaacttatttggttacttgtgttttttttttttttttgcgaatttgtctgaattc |
45070368 |
T |
 |
| Q |
93 |
ttgccctaagatgtttttatttttaatattgtctctcaatatagttcgtgtcgagtcccccgacagccaaagttcgtaccacctaggttgcacgtaccta |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45070369 |
ttgccctaagatgtttttatttttaatattggctctcaatatagttcgtgtcgagtcccccgacagccaaagttcgtaccacctaggttgcacgtaccta |
45070468 |
T |
 |
| Q |
193 |
gcaatgtgtattcttggattttaagtctgacacgact |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45070469 |
gcaatgtgtattcttggattttaagtctgacacgact |
45070505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University