View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8671_low_21 (Length: 245)
Name: NF8671_low_21
Description: NF8671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8671_low_21 |
 |  |
|
| [»] scaffold2041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold2041 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: scaffold2041
Description:
Target: scaffold2041; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 254 - 443
Alignment:
| Q |
1 |
tcaaaaaataaggttgtaataacgataacgaaagggacatctgataattttgtcctagctagtggaacaagaaagacatggatctatattcaatacgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
254 |
tcaaaaaataaggttgtaataacgataacgaaagggacatctgataattttgtcctagctagtggaacaagaaagacatggatctatattcaatacgcaa |
353 |
T |
 |
| Q |
101 |
tcaaaggatttctcccaacgaataattccccctgcttagttttcgctccgctcgtgcgtggcactccttgctggcggagcggcataccgg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
354 |
tcaaaggatttctcccaacgaataattccccctgcttagttttcgctccgctcgtgcgtggcactccttgctggcggagcggcataccgg |
443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 35
Target Start/End: Original strand, 35261036 - 35261068
Alignment:
| Q |
3 |
aaaaaataaggttgtaataacgataacgaaagg |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35261036 |
aaaaaataaggttgtaataacgataacgaaagg |
35261068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University