View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8671_low_22 (Length: 242)
Name: NF8671_low_22
Description: NF8671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8671_low_22 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 242
Target Start/End: Complemental strand, 3530165 - 3529943
Alignment:
| Q |
20 |
atcctagaattgaaacttaaatccttctcaatgtcaaaacttagaacatgtgaaagttggttagaagacactattaataatgattcttcttcaagttgtt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3530165 |
atcctagaattgaaacttaaatccttctcaatgtcaaaacttaaaacatgtgaaagttggttagaagacactattaataatgattcttcttcaacttgtt |
3530066 |
T |
|
| Q |
120 |
gttgatgcttttgttgttgctcttcctcactagcttgtttcatagctgctctatgaaacttcaaggcagttacaatttcttttctagcctcagccatatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3530065 |
gttgatgcttttgttgttgctcttcctcactagcttgtttcatagctgctctatgaaacttcaaggcagttacaatttcttttctagcctcagccatatt |
3529966 |
T |
|
| Q |
220 |
tagaagtctttcttgataaggtc |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3529965 |
tagaagtctttcttgataaggtc |
3529943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 241
Target Start/End: Original strand, 48682035 - 48682131
Alignment:
| Q |
145 |
ctcactagcttgtttcatagctgctctatgaaacttcaaggcagttacaatttcttttctagcctcagccatatttagaagtctttcttgataaggt |
241 |
Q |
| |
|
|||||| |||| |||||||| ||| || ||||| |||||||| || ||||| ||| | || ||||| |||||||| || || ||||||||||||||| |
|
|
| T |
48682035 |
ctcacttgcttctttcatagatgccctgtgaaatttcaaggcggtgacaatctctctccttgcctctgccatattcagtagcctttcttgataaggt |
48682131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University