View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8671_low_24 (Length: 233)
Name: NF8671_low_24
Description: NF8671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8671_low_24 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 166 - 233
Target Start/End: Original strand, 24551939 - 24552006
Alignment:
| Q |
166 |
gggaaatatagtattgttggaaagttaagaagagtacgcacgcaatgctagttttaaggaaaagttgt |
233 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24551939 |
gggaaatatagtagtgttggaaagttaagaagattacgcacgcaatgctagttttaaggaaaagttgt |
24552006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 24551802 - 24551844
Alignment:
| Q |
1 |
attttgtcctcctattaggcaagccttgtgcttgatgtgggtg |
43 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
24551802 |
attttgtcctcctattaggcagaccttgcgcttgatgtgggtg |
24551844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University