View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8671_low_26 (Length: 221)
Name: NF8671_low_26
Description: NF8671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8671_low_26 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 13834148 - 13833929
Alignment:
| Q |
1 |
agatgactttgaaaattcctggaaaaataccgttttttaaatgaatttttcatatttgtatctaagtaatatttatttggggttgtgagcaactaaatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13834148 |
agatgactttgaaaattcctggaaaaatatcattttttaaatgatttttt-atatttgtatctaagtaatatttatttggggttgtgagcaactaaatat |
13834050 |
T |
 |
| Q |
101 |
tttcatagaagtaatcccagtgcattgtttatttgacactttaatggatacttaagttaattaattagatatatgttgctggtgggaaataaattattaa |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
13834049 |
tttcataaaagtaatcccagtgcattgtttatttgacactttaatggatacttaagttaattaattagatatattttgctggtgggaaattaattattaa |
13833950 |
T |
 |
| Q |
201 |
ttagaacttataagtcggttt |
221 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
13833949 |
ttataacttataagtcggttt |
13833929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 102
Target Start/End: Complemental strand, 16574327 - 16574286
Alignment:
| Q |
61 |
tctaagtaatatttatttggggttgtgagcaactaaatattt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
16574327 |
tctaagtaatatttatttggggttgtgatcaactaactattt |
16574286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University