View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8671_low_28 (Length: 203)
Name: NF8671_low_28
Description: NF8671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8671_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 42837308 - 42837128
Alignment:
| Q |
1 |
acaaaattaggtataacagattgtacagaagaaagcatgtccatgtgcgacttgtgttgagtttctatgcgagctttaagactgtttataccttcatctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42837308 |
acaaaattaggtataacagattgtacagaagaaagcatgtacatgtgcgacttgtgttgagtttctatgcgagctttaagactgtttataccttcatctg |
42837209 |
T |
 |
| Q |
101 |
tctccatctccattgatgatgaatgattgattccgatcagatcaattctccaagcagtgcagcgatcttcaggttactggt |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42837208 |
tctccatctccattgatgatgaatgattgattccgatcagatcaattctccaagcagtgcagcgatcttcaggttactggt |
42837128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 8e-26; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 43915004 - 43915079
Alignment:
| Q |
1 |
acaaaattaggtataacagattgtacagaagaaagcatgtccatgtgcgacttgtgttgagtttctatgcgagctt |
76 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
43915004 |
acaagattaggtataacggattgtacagaagaaagcatgtccatgtgtgacttgtgttgggtttctatgcgagctt |
43915079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 81 - 132
Target Start/End: Original strand, 43915105 - 43915156
Alignment:
| Q |
81 |
actgtttataccttcatctgtctccatctccattgatgatgaatgattgatt |
132 |
Q |
| |
|
|||||||| |||||||||||||||||| | ||| ||||||||||||| |||| |
|
|
| T |
43915105 |
actgtttaaaccttcatctgtctccatgttcatggatgatgaatgatggatt |
43915156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University