View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8672_high_13 (Length: 374)

Name: NF8672_high_13
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8672_high_13
NF8672_high_13
[»] chr2 (1 HSPs)
chr2 (18-184)||(33017455-33017621)
[»] scaffold0107 (1 HSPs)
scaffold0107 (293-335)||(46243-46285)
[»] chr4 (1 HSPs)
chr4 (21-85)||(15799822-15799886)


Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 33017455 - 33017621
Alignment:
18 atatttagggatcacaattcagatgcaatcttatgtttctcagaacctattggtatttgcacatcttataatcaggttgagttatgtggatttatgagag 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||    
33017455 atatttagggatcacaattcagatgcaatcttatgtttctcagaacctattggtatttgcacatcttataatcaggctgagctatgtggatttatgagag 33017554  T
118 ctattgaaatcattttccaaaaccaatggaacaatatatgaattgaaactgattcttctttagtagt 184  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
33017555 ctattgaaatcatttcccaaaaccaatggaacaatatatgaattgaaactgattcttctttagtagt 33017621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0107 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0107
Description:

Target: scaffold0107; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 293 - 335
Target Start/End: Complemental strand, 46285 - 46243
Alignment:
293 gagaaggaaaccgagcagctgactctttggctaaccatggtct 335  Q
    |||||||||||| || ||| |||||||||||||||||||||||    
46285 gagaaggaaaccaagtagcagactctttggctaaccatggtct 46243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 15799886 - 15799822
Alignment:
21 tttagggatcacaattcagatgcaatcttatgtttctcagaacctattggtatttgcacatctta 85  Q
    |||||| |||| ||||||||||| || || ||||| ||||| |||||||||||| |||| |||||    
15799886 tttaggaatcataattcagatgctattttttgtttttcagatcctattggtattagcacttctta 15799822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University