View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_high_17 (Length: 328)
Name: NF8672_high_17
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 16 - 314
Target Start/End: Complemental strand, 1688809 - 1688507
Alignment:
| Q |
16 |
tctttttcagtatcatcattttttcctcttgcttcttacnnnnnnn-gtatcatg---tgtttgttccttattgctagaagaatttgattttctctctat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1688809 |
tctttttcagtatcatcattttttcctcttgcttcttacttttttttgtatcatgatgtgtttcttccttattgctagaagaatttgattttctctctat |
1688710 |
T |
 |
| Q |
112 |
taaatatgaactattttgagtttctttgttgacaactttggaagattcattagctttctgagcttccatttcttcaacttttttatcagatttaggatct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1688709 |
taaatatgaactattttgagtttctttgttgacaactttggaagattcattagctttctgagcttccatttcttcaacttttttatcagatttaggatct |
1688610 |
T |
 |
| Q |
212 |
gaaaaaatcatgtttttgctttgttcacaactaactgatttgacagggaacctcgcagcaagtgacataaatgcagagcttttgaaacaagaatgagtat |
311 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1688609 |
gaaaaaatcatgttgttgctttgttcacaactaactgatttgacagggaacctcgcagcaagtgacataaatgcagagcttttgaaacaagaatgagtat |
1688510 |
T |
 |
| Q |
312 |
tat |
314 |
Q |
| |
|
||| |
|
|
| T |
1688509 |
tat |
1688507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 215 - 293
Target Start/End: Complemental strand, 41919134 - 41919056
Alignment:
| Q |
215 |
aaaatcatgtttttgctttgttcacaactaactgatttgacagggaacctcgcagcaagtgacataaatgcagagcttt |
293 |
Q |
| |
|
|||| ||||||||||||||| |||| |||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41919134 |
aaaaccatgtttttgctttgctcaccgctaactaatttcacagggaacctcgcagcaagtgacataaatgcagagcttt |
41919056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University