View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_high_21 (Length: 318)
Name: NF8672_high_21
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 299
Target Start/End: Original strand, 40942627 - 40942907
Alignment:
| Q |
19 |
ggtctattaaagatcctttggatcagaggttttgtttcattgaatgttggaacaaacttatccttattcacgattttgttcgataggtttatttaggaga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942627 |
ggtctattaaagatcctttggatcagaggttttgtttcattgaatgttggaacaaacttgtccttattcacgattttgttcgataggtttatttaggaga |
40942726 |
T |
 |
| Q |
119 |
ttgaaaacatgaataaaaatctatccaactgttatgtttgcaggcaggatatttgcttcatgatcgtgttattcggccagcggaagttggtgtaacccaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942727 |
ttgaaaacatgaataaaaatctatccaactgttatgtttgcaggcaggatatttgcttcatgatcgtgttattcggccagcggaagttggtgtaacccaa |
40942826 |
T |
 |
| Q |
219 |
gcaaaagaaaatggcaattcagctgaatgatggtaaagataatatagctgataaggattcatatgattaagagattcctga |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40942827 |
gcaaaagaaaatggcaattcagctgaatgatggtaaagataatatagctgataaggattcgtatgattaagagattcctga |
40942907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University