View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_high_22 (Length: 318)
Name: NF8672_high_22
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 23 - 307
Target Start/End: Original strand, 40286828 - 40287112
Alignment:
| Q |
23 |
aagtaaagccatgtcaggaacaaaattggcttattatgggtgatgtatgtatgaatgagtggtgaacatttgctcttggaaggtaactatctatccaatc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40286828 |
aagtaaagccatgtcaggaacaaaattggcttattatgggtgatgtatgtatgaatgagtggtgaacatttgctcttggaaggtaactatctatccaatc |
40286927 |
T |
 |
| Q |
123 |
atcatcatcatgctaatgcacattttcaatgcacatatgtgcaattaccttttttcaaagatatagattaagaaaattaatttacgaacaaataaatgta |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40286928 |
atcatcatcatgctaatgcacattttcaatgcacatatgtgcaattaccttttttcaaagatatagattaagaaaattaatttatgaacaaataaatgta |
40287027 |
T |
 |
| Q |
223 |
acaattttataaagtcatctttaataggtattgactattaataattctaatattctacaactagtgaggttcctttcatattcat |
307 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40287028 |
acaattttataaagtcatctttaatagctattgactattaataattctaatattctacaactagtgaggttcctttcatattcat |
40287112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University