View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8672_high_24 (Length: 310)

Name: NF8672_high_24
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8672_high_24
NF8672_high_24
[»] chr2 (1 HSPs)
chr2 (230-304)||(39964018-39964095)


Alignment Details
Target: chr2 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 230 - 304
Target Start/End: Complemental strand, 39964095 - 39964018
Alignment:
230 caaaataaaatgaaatatatta---caaacaatgaaacattatatcttgcacaagatgtgccgttgtagaacacgaaa 304  Q
    ||||| ||||||||||||||||   |||||||||||||||||||||||||| |||| |||||||||||||||||||||    
39964095 caaaacaaaatgaaatatattattacaaacaatgaaacattatatcttgcataagaagtgccgttgtagaacacgaaa 39964018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University