View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8672_high_40 (Length: 232)

Name: NF8672_high_40
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8672_high_40
NF8672_high_40
[»] chr4 (1 HSPs)
chr4 (1-230)||(40127190-40127419)


Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 40127190 - 40127419
Alignment:
1 caaacagtaacttaggacgatcttggcttctcacattcaccacccagtaatctctcccctggtatctatctaccgaaacatgggtcccatcatactgcct 100  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
40127190 caaacagtaacttaggacgatctcggcttctcacattcaccacccagtaatctctcccctggtatctatccaccgaaacatgggtcccatcatactgcct 40127289  T
101 tttgtgctcactgtcattatccccgtggcaggcatgacaactctcgtagtcaccggctgcgtacatcatctggtggagcctccgttcggtatgactgtgc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||    
40127290 tttgtgctcactgtcattatccccgtggcaggcatgacaactctcgtagtcactggctgcgtacatcatctggtggagcctccgttcagtatgactgtgc 40127389  T
201 ccggtggtagagctttttaacaccaaactc 230  Q
    |||||||| |||||||||||||||| ||||    
40127390 ccggtggtggagctttttaacaccacactc 40127419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University