View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_high_41 (Length: 230)
Name: NF8672_high_41
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 43598619 - 43598813
Alignment:
| Q |
18 |
tactatacttaccgttaatttaagcatgcacgtccatttcttacagtttctaaatatatgcaacaaattaatcaatgattttatgtttgtaattttatca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43598619 |
tactatacttaccgttaatttaagcatgcacgtccatttcttacagtttcttaatatatgcaacaaattaatcaatgattttatgtttgtaattttatca |
43598718 |
T |
 |
| Q |
118 |
ggtgattgccacatttactgcaattggaatcatctttatccctattggtcttgcatcattgttttcatcagggaaggtaatgaacataacaatgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43598719 |
ggtgattgccacatttactgcaattggaataatctttatccctattggtcttgcatcattgttttcatcagggaaggtaatgaacataacaatgt |
43598813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University