View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_high_42 (Length: 228)
Name: NF8672_high_42
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 12 - 177
Target Start/End: Original strand, 55078738 - 55078903
Alignment:
| Q |
12 |
gtttggtggtggcaacttgccggcgtttgtggtcggtgttgtggccgcagtcatcagcgctatattggcggtaattattcttcctactccaaagtctgtt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55078738 |
gtttggtggtggcaacttgccggcgtttgtggtcgatgctgtggccgcagtcatcagcgctgtattggcggtaattattcttcctactccaaagtctgtt |
55078837 |
T |
 |
| Q |
112 |
gatactgccaagccttcgattgccacctctggtggccatcattgatgatcagagtttaaatgttta |
177 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55078838 |
gatactgccaagccatcgattgccacctctggtggccatcattgatgatcagagtttaaatgttta |
55078903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 105
Target Start/End: Complemental strand, 15123108 - 15123015
Alignment:
| Q |
12 |
gtttggtggtggcaacttgccggcgtttgtggtcggtgttgtggccgcagtcatcagcgctatattggcggtaattattcttcctactccaaag |
105 |
Q |
| |
|
|||||||||||||||||| || ||||| ||||| |||| ||||| ||||||||||| |||| |||||| | || |||| |||||||||||| |
|
|
| T |
15123108 |
gtttggtggtggcaacttacctgcgttcgtggttggtgcggtggcggcagtcatcagtgctacattggcaattatccttctgcctactccaaag |
15123015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University