View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_low_16 (Length: 374)
Name: NF8672_low_16
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_low_16 |
 | |
|
| [»] scaffold0107 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 33017455 - 33017621
Alignment:
| Q |
18 |
atatttagggatcacaattcagatgcaatcttatgtttctcagaacctattggtatttgcacatcttataatcaggttgagttatgtggatttatgagag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
33017455 |
atatttagggatcacaattcagatgcaatcttatgtttctcagaacctattggtatttgcacatcttataatcaggctgagctatgtggatttatgagag |
33017554 |
T |
|
| Q |
118 |
ctattgaaatcattttccaaaaccaatggaacaatatatgaattgaaactgattcttctttagtagt |
184 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33017555 |
ctattgaaatcatttcccaaaaccaatggaacaatatatgaattgaaactgattcttctttagtagt |
33017621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0107 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0107
Description:
Target: scaffold0107; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 293 - 335
Target Start/End: Complemental strand, 46285 - 46243
Alignment:
| Q |
293 |
gagaaggaaaccgagcagctgactctttggctaaccatggtct |
335 |
Q |
| |
|
|||||||||||| || ||| ||||||||||||||||||||||| |
|
|
| T |
46285 |
gagaaggaaaccaagtagcagactctttggctaaccatggtct |
46243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 15799886 - 15799822
Alignment:
| Q |
21 |
tttagggatcacaattcagatgcaatcttatgtttctcagaacctattggtatttgcacatctta |
85 |
Q |
| |
|
|||||| |||| ||||||||||| || || ||||| ||||| |||||||||||| |||| ||||| |
|
|
| T |
15799886 |
tttaggaatcataattcagatgctattttttgtttttcagatcctattggtattagcacttctta |
15799822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University