View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_low_19 (Length: 358)
Name: NF8672_low_19
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 21 - 346
Target Start/End: Complemental strand, 48877036 - 48876712
Alignment:
| Q |
21 |
actgtggcaatccggtgcattgcaaagaggttgctctgaacttcagcgagatggccagtaagttcatggctatacgaatagannnnnnnnngtccagatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48877036 |
actgtggcaatccggtgcattgcaaagaggttgctctgaacttcagcgagatcgccagtaagttcatggctatacgaatagatttttttttgtccagatg |
48876937 |
T |
|
| Q |
121 |
cagtaacatcaacagttcttctgttcacgttcttcagccaagcaaaactagccgagggacaagctttggccccatttggtaaaatcatatctactggcat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48876936 |
cagtaacatcaacagttcttctgttcacgttcttcagccaagcaaaactagccgagggacaagctttggccccatttggtaaa-tcatatctactggcat |
48876838 |
T |
|
| Q |
221 |
ttcttaataattttgcaacgagaaaaatgaatgcttgtgatacactcattgccaagtagtttatagttcttacatttttgttcaataattatcaaagtat |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48876837 |
ttcttaataattttgcaatgagaaaaatgaatgcttgtgatacactcattgccaagtagtttatagttcttacatttttgttcaataattatcaaagtat |
48876738 |
T |
|
| Q |
321 |
tttcgaagtaccaactttatgttctt |
346 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48876737 |
tttcgaagtaccaactttatgttctt |
48876712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 124 - 191
Target Start/End: Original strand, 8381353 - 8381420
Alignment:
| Q |
124 |
taacatcaacagttcttctgttcacgttcttcagccaagcaaaactagccgagggacaagctttggcc |
191 |
Q |
| |
|
||||||||||||||||||| |||| |||||| |||| | ||| ||||| |||| ||||||||||||| |
|
|
| T |
8381353 |
taacatcaacagttcttctattcaagttcttgagccgatcaatgctagctgaggaacaagctttggcc |
8381420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 116 - 191
Target Start/End: Original strand, 53456785 - 53456860
Alignment:
| Q |
116 |
agatgcagtaacatcaacagttcttctgttcacgttcttcagccaagcaaaactagccgagggacaagctttggcc |
191 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||| || | ||||||||||||| |
|
|
| T |
53456785 |
agatgcaataacatcaacagttcttctgttcacattcttcagccaagcaacactagctgaagaacaagctttggcc |
53456860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University