View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_low_25 (Length: 328)
Name: NF8672_low_25
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 48817286 - 48817549
Alignment:
| Q |
1 |
cgcagagccagccatcatgaagattcaagcttcaagaaatcaagatgtggtgaacgatg---atgattcttcttcacgtcaaagggaaacgctttcgccg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48817286 |
cgcagagccagccatcatgaagattcaagcttcaataa-tcaagatgtggtgaacgatgatgatgattcttcttcacgtcaaagggaaacgctttcgccg |
48817384 |
T |
 |
| Q |
98 |
ctgaagatattgacaatatcgcacagttttcgctttgtccccgctgtttctatttgtgtctgtaaaagtgtcgcatttttgctcacggaatccaaaacca |
197 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48817385 |
cagaagatattgacaatatcacacagttttcgctttgtccccgctgtttctatttgtgtctgtaaaagtgtcgcatttttgctcacggaatccaaaacca |
48817484 |
T |
 |
| Q |
198 |
attttgccaaggaagtgaatacccaatttgcccccaaaagttgtataactaactcaaaggtaatt |
262 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48817485 |
attttgctaaggaagtgaatacccaatttgcccccaaaagttgtataactaactcaaaggtaatt |
48817549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 262 - 314
Target Start/End: Original strand, 48818530 - 48818582
Alignment:
| Q |
262 |
ttcttagaaatgggtcaatttatagaaaacttggtaaaataaatgatagtgtt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48818530 |
ttcttagaaatgggtcaatttatagaaaacttggtaaaataaatgatagtgtt |
48818582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University