View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_low_31 (Length: 311)
Name: NF8672_low_31
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 42408967 - 42408673
Alignment:
| Q |
1 |
aaatctaactgcgccaaagacgacgaaaaaactcacttggaaccacctaagaggagtacacatcaagtttctcttgaaactccttctcagcaagtgcctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42408967 |
aaatctaactgcgccaaagacgacgaaaaaactcacttggaaccacctaagaggagtacacatcaagtttctcttgaaactacttctcagcaagtgcctg |
42408868 |
T |
 |
| Q |
101 |
actttacacccccttggggtgttgatgacttattggagttagcagactttaattctcatgacaaagtaagacttacaactttatttcataattggaatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42408867 |
actttacacccccttggggtgttgatgacttattggagttagcagactttaattcccatgacaaagtaagacttacaactttatttcataattggaatta |
42408768 |
T |
 |
| Q |
201 |
catatatgtcatgaacactaacacaaaatttgttacatgtccttagttaattaatcgattttaaactttgtttttagtccttcaatccacttttc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
42408767 |
catatatgtcatgaacactaacacaaaatttgtaacatgtccttagttgattaatcgattttaaacttcgtttttagtcctttaatccacttttc |
42408673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University