View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_low_32 (Length: 310)
Name: NF8672_low_32
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 230 - 304
Target Start/End: Complemental strand, 39964095 - 39964018
Alignment:
| Q |
230 |
caaaataaaatgaaatatatta---caaacaatgaaacattatatcttgcacaagatgtgccgttgtagaacacgaaa |
304 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
39964095 |
caaaacaaaatgaaatatattattacaaacaatgaaacattatatcttgcataagaagtgccgttgtagaacacgaaa |
39964018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University