View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_low_49 (Length: 240)
Name: NF8672_low_49
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_low_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 5 - 225
Target Start/End: Complemental strand, 28415600 - 28415382
Alignment:
| Q |
5 |
ttgtttttgcctttagctcaagaatttagttttagtacatttcgctctcaacattgcacgagagactatagttaactactaatttagaggaaggggtttt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28415600 |
ttgtttttgcctttagctcaagaatttagttttagtacatttcgctctcaacattgc-cgagagactatagttaactactaatttagaggaaggggtttt |
28415502 |
T |
|
| Q |
105 |
agttggtgagcatttgactaaacaaggtaatctctgtttaatggtttattcaacaagctcttaccgaatgagaggttatagcttaagcactaagtctaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28415501 |
agttggtgagcatttgactaaacaaggtaatctctgtttaat-gtttattcaacaagctcttaccgaatgagaggttatagcttaagcactaagtctaaa |
28415403 |
T |
|
| Q |
205 |
ttcaataatttgttagtgttt |
225 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
28415402 |
ttcaataagttgttagtgttt |
28415382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University