View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_low_50 (Length: 239)
Name: NF8672_low_50
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 17 - 235
Target Start/End: Complemental strand, 35042873 - 35042653
Alignment:
| Q |
17 |
atcagtgaccatggagagtgacccctcttgtctccattctttcttcccttattgttggcataaaaattctaatgcattttgtta-aaaattaagagaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||| || |
|
|
| T |
35042873 |
atcagtgaccatggagagtgacccctcttgtctccattctttcttcccttattgttggcataaaaattataatgcattttgttaaaaaaataagagataa |
35042774 |
T |
 |
| Q |
116 |
gtatctcattgacttacggggttgacctggtagta---taagcttgagacaaacaaatgtgcttctttttaggtctttaagtttgaattctttttgtgct |
212 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||| ||||||||||||| || | ||| ||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
35042773 |
ctatctcattgacttac-aggttgacctagtagtagtgtaagcttgagacacacgagtgtacttctttttagatc-ttaagtttgaattctttttgtgct |
35042676 |
T |
 |
| Q |
213 |
aacaattcattcgttggatcaat |
235 |
Q |
| |
|
||||||||||| ||| ||||||| |
|
|
| T |
35042675 |
aacaattcatttgttagatcaat |
35042653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University