View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_low_53 (Length: 232)
Name: NF8672_low_53
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 40127190 - 40127419
Alignment:
| Q |
1 |
caaacagtaacttaggacgatcttggcttctcacattcaccacccagtaatctctcccctggtatctatctaccgaaacatgggtcccatcatactgcct |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40127190 |
caaacagtaacttaggacgatctcggcttctcacattcaccacccagtaatctctcccctggtatctatccaccgaaacatgggtcccatcatactgcct |
40127289 |
T |
|
| Q |
101 |
tttgtgctcactgtcattatccccgtggcaggcatgacaactctcgtagtcaccggctgcgtacatcatctggtggagcctccgttcggtatgactgtgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40127290 |
tttgtgctcactgtcattatccccgtggcaggcatgacaactctcgtagtcactggctgcgtacatcatctggtggagcctccgttcagtatgactgtgc |
40127389 |
T |
|
| Q |
201 |
ccggtggtagagctttttaacaccaaactc |
230 |
Q |
| |
|
|||||||| |||||||||||||||| |||| |
|
|
| T |
40127390 |
ccggtggtggagctttttaacaccacactc |
40127419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University