View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_low_58 (Length: 218)
Name: NF8672_low_58
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_low_58 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 125 - 202
Target Start/End: Original strand, 37012744 - 37012821
Alignment:
| Q |
125 |
catcgtttcataatactgtcgtctctcatactgatgcaaagtgtggtgatgcaataggaaatcgaatggtgatgttgt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37012744 |
catcgtttcataatactgtcgtctctcatactgattcaaagtgtggtgatacaataggaaatcgaatggtgatgttgt |
37012821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 40 - 77
Target Start/End: Original strand, 37012710 - 37012747
Alignment:
| Q |
40 |
caaatttattattctggtggtgaagccaagaattcatc |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37012710 |
caaatttattattctggtggtgaagccaagaattcatc |
37012747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University