View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8672_low_59 (Length: 212)
Name: NF8672_low_59
Description: NF8672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8672_low_59 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 29553002 - 29552819
Alignment:
| Q |
16 |
tcaaaacagataccgcaagtaagctttttagcattaggattctcataaactggcttctccaacaagccaacttttctccggactctatcttcgtcagcaa |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| | |||||||| |||| |||||||||||||| ||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
29553002 |
tcaaaacagatgccgcaagtaagctttttagcatcatgattctcacaaaccggcttctccaacaaaccaacttttcttcggactccgtcttcatcagcaa |
29552903 |
T |
|
| Q |
116 |
accaagcttcattaacgttactgacgttccaattataatgacgaagtaggatgcttgcagcaactggtggtatggaaagaactg |
199 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29552902 |
accaagcttcattaacattactgacattccaattataatgacgaagtaggatgcttgcagcaactggtggtatggaaagaactg |
29552819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 43 - 199
Target Start/End: Complemental strand, 29537845 - 29537689
Alignment:
| Q |
43 |
ttagcattaggattctcataaactggcttctccaacaagccaacttttctccggactctatcttcgtcagcaaaccaagcttcattaacgttactgacgt |
142 |
Q |
| |
|
||||||| |||||||| |||| |||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||| |||||||| | |
|
|
| T |
29537845 |
ttagcatcaggattcttataagctggcttctccaacaagccaacttttcttcggactccgtcttcatcagcaaaccaagcttcattaacattactgacat |
29537746 |
T |
|
| Q |
143 |
tccaattataatgacgaagtaggatgcttgcagcaactggtggtatggaaagaactg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29537745 |
tccaattataatgacgaagtaggatgcttgcagcaacaggtggtatggaaagaactg |
29537689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 46 - 145
Target Start/End: Complemental strand, 42188833 - 42188734
Alignment:
| Q |
46 |
gcattaggattctcataaactggcttctccaacaagccaacttttctccggactctatcttcgtcagcaaaccaagcttcattaacgttactgacgttcc |
145 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
42188833 |
gcatcaggattctcgtaaactggcttctccaacaagccaacttttcttcggactctgtcttcgtcagcaaaccaagcatcattaacattactgacattcc |
42188734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 144 - 199
Target Start/End: Complemental strand, 42188591 - 42188536
Alignment:
| Q |
144 |
ccaattataatgacgaagtaggatgcttgcagcaactggtggtatggaaagaactg |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42188591 |
ccaattgtaatgacgaagtaggatgcttgcagcaactggtggtatggaaagaactg |
42188536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University