View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8673_high_13 (Length: 228)
Name: NF8673_high_13
Description: NF8673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8673_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 9 - 205
Target Start/End: Complemental strand, 44348069 - 44347888
Alignment:
| Q |
9 |
agtagcagagataagacaattaaattgtaccctggaatgtggcatggtttaacatctggtgagcctgatgacaacattgaaaaagtttttgaagacatca |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44348069 |
agtagcaaagataagacaattaaattgtaccctggaatgtggcatggtttaacatctggtgagcctgatgacaacattgaaaaagtttttgaagacatca |
44347970 |
T |
|
| Q |
109 |
tcacgtggcttgacaagcacgccaacaatgatgcctatgaatctacacatccaattgagaattgtaaccatgacattgagacattgacaccagttgt |
205 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44347969 |
tcacatggcttgacaagcacgccaacaatgatg---------------atccaattgagaattgtaaccatgacattgagacattgacaccagttgt |
44347888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 39562604 - 39562662
Alignment:
| Q |
21 |
aagacaattaaattgtaccctggaatgtggcatggtttaacatctggtgagcctgatga |
79 |
Q |
| |
|
||||| || |||||||||||||||||||||||||| |||||| |||| ||||||||||| |
|
|
| T |
39562604 |
aagaccataaaattgtaccctggaatgtggcatggcttaacagctggggagcctgatga |
39562662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 59
Target Start/End: Complemental strand, 52216378 - 52216331
Alignment:
| Q |
12 |
agcagagataagacaattaaattgtaccctggaatgtggcatggttta |
59 |
Q |
| |
|
|||| |||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
52216378 |
agcaaagataagacactgaaattgtaccctggaatgtggcatggttta |
52216331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University