View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8673_high_14 (Length: 225)

Name: NF8673_high_14
Description: NF8673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8673_high_14
NF8673_high_14
[»] chr8 (1 HSPs)
chr8 (70-125)||(29222040-29222095)


Alignment Details
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 70 - 125
Target Start/End: Complemental strand, 29222095 - 29222040
Alignment:
70 ccaaattacgtaccttcttcttttgcccctgattttttctgaaatttcactcagtg 125  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
29222095 ccaaattacgtaccttcttcctttgcccctgattttttctgaaatttcactcagtg 29222040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University