View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8673_high_9 (Length: 263)
Name: NF8673_high_9
Description: NF8673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8673_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 4 - 251
Target Start/End: Complemental strand, 19171973 - 19171726
Alignment:
| Q |
4 |
ttgtttcttgaagctttgtctatgtttcttattggatttaaagatcatgatttggttcatgctgtggaacattccaagaatttttctgttgatcatgcta |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19171973 |
ttgtttcttgaagctttgtctatgtttcttattggatttaaagatcatgatttggttcatgctgtggaacattccaagagtttttctgttgatcatgcta |
19171874 |
T |
 |
| Q |
104 |
aagatcataaagatttttgtcgttcgaggtgtcactgattcgttggttcaatcatcatcaatggaagaaagaggaatattggcttgacagtttctgtgca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19171873 |
aagatcataaagatttttgtcgttcgaggtgtcactgattcgttggttcaatcatcatcaatggaagaaagaggaatattggcttgacagttgctgtgca |
19171774 |
T |
 |
| Q |
204 |
ttatgtaatttccatttctttcttcttcttttggtatgtatgtgatgt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19171773 |
ttatgtaatttccatttctttcttcttcttttggtatgtatgtaatgt |
19171726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University