View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8673_low_23 (Length: 223)
Name: NF8673_low_23
Description: NF8673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8673_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 212
Target Start/End: Original strand, 5414059 - 5414258
Alignment:
| Q |
13 |
catcatcctcctcctcaacatggtgttgttggggttggagctcagactcgtgcacctgagatggttcagatctatcagtactacggtctctgcccctacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5414059 |
catcatcctcctcctcaacatggtgttgttggggttggagctcatactcgtgcacctgagatggttcagatctatcagtactacggtctctgcccctacc |
5414158 |
T |
|
| Q |
113 |
cctgcccactctcccttctgctacaaccttctgcatccgctatcacttaatggatgcagtcatgactggttatgtagtttctaatgcggtatatgatgtc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5414159 |
cctgcccactctcccttctgctacaaccttctgcatccgctatcacttaatggatgcagtcatgactggttatgtagtttctaatgcggtatatgatgtc |
5414258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 97
Target Start/End: Complemental strand, 40570215 - 40570143
Alignment:
| Q |
25 |
cctcaacatggtgttgttggggttggagctcagactcgtgcacctgagatggttcagatctatcagtactacg |
97 |
Q |
| |
|
|||||||| ||||||||||||| | | | |||| ||||||||| |||||||| |||||| ||| |||||||| |
|
|
| T |
40570215 |
cctcaacacggtgttgttggggctcgggttcagtctcgtgcactagagatggtccagatccatcggtactacg |
40570143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University