View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8674_high_2 (Length: 259)
Name: NF8674_high_2
Description: NF8674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8674_high_2 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 259
Target Start/End: Complemental strand, 32802408 - 32802171
Alignment:
| Q |
13 |
gagtttggtgttattgttagctatattgatcaggtttggtcttccaacccactgcttccagctgatgcatatgatcttgcacaagctagatttttggctg |
112 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32802408 |
gagtctggtattattgttagctatattgatcaggtttggtcttccaacccactgcttccagctgatgcatatgatcttgcacaagctagatttttggctg |
32802309 |
T |
 |
| Q |
113 |
atttcattgacaaaaaggttagttgcactattcttaagtagcgttataacatgtaaaaagaaaagaacctgttttgtcattattttttgttccatattta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32802308 |
atttcattgacaaaaaggttagttgcactatttttaagtagtgttataacacgtaaaaagaaaagaacctgttttgtcattattttttgttccatatt-- |
32802211 |
T |
 |
| Q |
213 |
agttccagaaacatctatgtacatgtttggaataactgaatttgacg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32802210 |
-------gaaacatctatgtacatgtttggaataactgaatttgacg |
32802171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University