View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8674_high_3 (Length: 239)
Name: NF8674_high_3
Description: NF8674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8674_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 32802151 - 32801928
Alignment:
| Q |
1 |
gttttgttgaagttctagagtagcttttgcaaaatttggtggcacattgtaattccgtatatctaaaagtcaatccaaacatgtaccaagtaaaatattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32802151 |
gttttgttgaagttctagagtagcttttgcaaaatttggtggcacattgtaattccgtatatctaaaagtcaatccaaacatgtaccaagtaaaatattt |
32802052 |
T |
|
| Q |
101 |
ctacgctgattttctagacatatgtgttaaacattttttacattatcgatctgtgatattcattaaattcttaaaagcttgtcctatggtcctaatattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32802051 |
ctacgctgattttctagacatatgtgttaaacattttttacattatcgatctatgatattcattaaattcttaaaagcttgtcctatggtcctaatattt |
32801952 |
T |
|
| Q |
201 |
agaaatggaaccaaa-gttacatt |
223 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
32801951 |
agaaatggaaccaaacgttacatt |
32801928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University