View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8674_low_6 (Length: 214)
Name: NF8674_low_6
Description: NF8674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8674_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 3002949 - 3002768
Alignment:
| Q |
19 |
atgacacactcaccaaattaaattcttcactttcgatggaactttcaaacaccaaatgcaatcccaattccctaccacacctttcattttcaaatgaccg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3002949 |
atgacacactcaccaaattaaattcttcactttcgatggaactttcaaacaccaaatgcaatcccaattccctaccacacctttcattttcaaatgaccg |
3002850 |
T |
|
| Q |
119 |
acattaatcaactcattgatgcacaacttataagcactttgcattgaataattcccatggtttccaccttccatatgtgtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3002849 |
acattaatcaactcattgatgcacaacttataagcactttgcattgaataattcccatggtttccaccttccatatgtgtct |
3002768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University