View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8675_low_7 (Length: 326)
Name: NF8675_low_7
Description: NF8675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8675_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 11 - 153
Target Start/End: Complemental strand, 6454948 - 6454806
Alignment:
| Q |
11 |
tgagaagaaagaaacatgatgatattgagtttgatcgtggtaactaaaatatggacaagaattgtttcactcataaatcaaactagattcttctgaataa |
110 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454948 |
tgagaagaaagaaacatgatgatatggagtttgatcgtggtaactaaaatatggataagaattgtttcactcataaatcaaactagattcttctgaataa |
6454849 |
T |
|
| Q |
111 |
tccgtccttagtagagttcactaatcacttgattctaatatct |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454848 |
tccgtccttagtagagttcactaatcacttgattctaatatct |
6454806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 244 - 303
Target Start/End: Complemental strand, 6454714 - 6454651
Alignment:
| Q |
244 |
catcggtggaaacaagttagaaaaggtaa----taatatttgaacacgattttcatatgatacc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6454714 |
catcggtggaaacaagttagaaaaggtaataattaatatttgaacacgattttcatatgatacc |
6454651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University