View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8676_high_12 (Length: 229)
Name: NF8676_high_12
Description: NF8676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8676_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 53022947 - 53023140
Alignment:
| Q |
17 |
tggtgtttggcgggatcgagaaggctaaatgaaagggagagaattaggacaaacctaacacatgttgacaactaaattgaattataaaacgaagtattta |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53022947 |
tggtgtttggcgggatcaagaaggctaaatgatagggagagaattaggacaaacctaacacatgttgacaactaaattgaattataaaacgaggtattta |
53023046 |
T |
 |
| Q |
117 |
ccgtaaacaaaagaatattcatttgcaaataaaatatatatcaaaatatgcatcaaatatcttgaacattcaagtattgagattgtgcagtttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53023047 |
ccgtaaacaaaagaatattcatttgcaaataaaatatatatcaaaatatgcatcaaatatcttgaacattcaagtattgagattgtgcagtttt |
53023140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University