View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8676_high_7 (Length: 300)
Name: NF8676_high_7
Description: NF8676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8676_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 4 - 191
Target Start/End: Complemental strand, 49202453 - 49202266
Alignment:
| Q |
4 |
aataacatgatctcaccatatcagatgtaatgtcatcttctgtagttccaaaggggacaacagtgcttataataagaaacttgtctttgcaatgcatatc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49202453 |
aataacatgatctcaccatatcagatgtaatgtcatcttctgtagttccaaaggggacaacagtgcttataataagaaacttgtctttgcaatgcatatc |
49202354 |
T |
 |
| Q |
104 |
aggcggtgccgtgcgttgagcttgcatcgtaactagtacatccaaaaaataaacataagccagtaacttgtgttacttgaatcatact |
191 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49202353 |
agggggtgccgtgcgttgagcttgcatcgtaactagtacatccaaaaaataaacataagccaataacttgtgttacttgaatcatact |
49202266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 264
Target Start/End: Complemental strand, 49202224 - 49202195
Alignment:
| Q |
235 |
tgaattgagccttaaacaagaaggtaaatg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49202224 |
tgaattgagccttaaacaagaaggtaaatg |
49202195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University