View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8676_low_11 (Length: 239)
Name: NF8676_low_11
Description: NF8676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8676_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 3629316 - 3629522
Alignment:
| Q |
14 |
gtttcgtgtttaggggtgggtgaagaagagggttcttcgattaatgaagctagttctgttgccaacgtgtgttgagaatgatgtttacctgnnnnnnnga |
113 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3629316 |
gtttcgggtttaggggtgggtgaagaagagggttcttcgattaatgaagctagttctgttgccaacgtgtgttgagaatgatgtttacctgaaaaaaaga |
3629415 |
T |
 |
| Q |
114 |
atatgatagttgagtgtttttgttagtgttgtgatttataaggggaaatgctaagtaaagtgtgtacctggaaaggagaaaggagaggtgaatctgagga |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3629416 |
atatgatagctgagtgtttttgttagtgttgtgatttataaggggaaatgctaagtaaagtgtgtacctggaaaggagaaaggagaagtgaatctgagga |
3629515 |
T |
 |
| Q |
214 |
aggagaa |
220 |
Q |
| |
|
||||||| |
|
|
| T |
3629516 |
aggagaa |
3629522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University