View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8676_low_12 (Length: 230)
Name: NF8676_low_12
Description: NF8676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8676_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 214
Target Start/End: Original strand, 45866784 - 45866978
Alignment:
| Q |
20 |
agaaggcaaaataagaagtatacttattttgtttttaaggctccacgagagcacttgatgccccgttggtttcatggaaaatatcttctcagttgccagc |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45866784 |
agaaagcaaaataagaagtatacttattttctttttaaggctccacgagagcacttgatgccccgttggtttcatggaaaatatcttctcagttgccagc |
45866883 |
T |
|
| Q |
120 |
atttggtgcacaactcaagaaataactttttcataatatttagttgatccacaaaaatctacctaccaatagaacacaatagaatagctaacaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45866884 |
atttggtgcacaactcaagaaataactttttcataatatttagttgatccacaaaaatctacctaccaatagaacacaatagaatagctaacaaa |
45866978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 84 - 131
Target Start/End: Complemental strand, 17403308 - 17403261
Alignment:
| Q |
84 |
gttggtttcatggaaaatatcttctcagttgccagcatttggtgcaca |
131 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17403308 |
gttgatttcatggaaaatatcttctcagttgccagcatttggtgcaca |
17403261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University