View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8676_low_15 (Length: 221)
Name: NF8676_low_15
Description: NF8676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8676_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 64 - 209
Target Start/End: Original strand, 2873817 - 2873961
Alignment:
| Q |
64 |
aactacgttatgctatatatttctatagcatttgatgtaataatatatattcatctcaatgaattttgatatactaggcaacttcaactgaaggccaaga |
163 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2873817 |
aactacattatgctatatatttctatagcatttgatgtaataatatatattcatctcaatgaattttgatatactaggcaacttcaactgaaggccaaga |
2873916 |
T |
 |
| Q |
164 |
ggaaagtctgataacagactatatgctgaaggtaaataatactatt |
209 |
Q |
| |
|
||||||||||||||| || |||||||||||||| |||||||||||| |
|
|
| T |
2873917 |
ggaaagtctgataaccgattatatgctgaaggt-aataatactatt |
2873961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 2873780 - 2873824
Alignment:
| Q |
1 |
gacccagatattgatgtctacatgaaggtgagaaagaaactacat |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2873780 |
gacccagatattgatgtctacatgaaggtgagaaagaaactacat |
2873824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 44214051 - 44214023
Alignment:
| Q |
1 |
gacccagatattgatgtctacatgaaggt |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44214051 |
gacccagatattgatgtctacatgaaggt |
44214023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 44226216 - 44226188
Alignment:
| Q |
1 |
gacccagatattgatgtctacatgaaggt |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44226216 |
gacccagatattgatgtctacatgaaggt |
44226188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 44237030 - 44237002
Alignment:
| Q |
1 |
gacccagatattgatgtctacatgaaggt |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44237030 |
gacccagatattgatgtctacatgaaggt |
44237002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University