View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8676_low_17 (Length: 217)
Name: NF8676_low_17
Description: NF8676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8676_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 31785949 - 31786163
Alignment:
| Q |
1 |
agggtaattgtgtgtggcagtttcatccctcaagatgttgcaatcaagataaaaaagaaaacaaatcgaagagttgagatattggacatacaagatttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31785949 |
agggtaattgtgtgtggcagtttcatccctcaagatgttgcaatcaagataaaaaagaaaacaaatcgaagagttgagatattggacatacaagatttga |
31786048 |
T |
 |
| Q |
101 |
gtgaaaacaatgctgaaaatatagaagaacagaaaccaagcactagcccccaaaagccaattgaaagaaatatgtttggattgatagaaacaaagagaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31786049 |
gtgaaaacaatgctgaaaatatagaagaacagaaaccaagcactagcccccaaaagccaattgaaagaaatatgtttggattgatagaaacaaagagaga |
31786148 |
T |
 |
| Q |
201 |
aatgcctgccctcaa |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31786149 |
aatgcctgccctcaa |
31786163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University